MIIP (NM_021933) Human 3' UTR Clone

CAT#: SC202929

3' UTR clone of migration and invasion inhibitory protein (MIIP) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name MIIP (NM_021933) Human 3' UTR Clone
Vector pMirTarget
Synonyms IIP45
ACCN NM_021933
Insert Size 267 bp
Sequence Data
>SC202929 3’UTR clone of NM_021933
The sequence shown below is from the reference sequence of NM_021933. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGGCCCCACGTCCCACGGCAGAAGCCCTGAGGACTGACTCCTGGGGGAGAACAGCATTCCCGCCGCCTC
CAGCCTCTCCCCTCTGGCAGGCGCACCCAGGAGATGGAATCCCCTGCCCGCCCAGCTCAGGCCCAGCTG
TCCTAGGTTGGGCAGGTGGGTGGACCCAAGCTTGTCTGCTGCCTGAGTTCCAGAGAGGGAGGACCCTGG
GGTGGAGGGTGAGGGATTCTGTGGAAGTTTGTAAATAAAGCTCAGTGCTCTGCAGCTCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_021933.4
Synonyms IIP45
Summary This gene encodes a protein that interacts with the oncogene protein insulin-like growth factor binding protein 2 and may function as an inhibitor of cell migration and invasion. This protein also interacts with the cell division protein 20 and may be involved in regulating mitotic progression. This protein may function as a tumor suppressor by inhibiting the growth or certain cancers. [provided by RefSeq, Sep 2011]
Locus ID 60672
MW 9.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...