AKAP3 (NM_006422) Human 3' UTR Clone

CAT#: SC202828

3' UTR clone of A kinase (PRKA) anchor protein 3 (AKAP3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name AKAP3 (NM_006422) Human 3' UTR Clone
Vector pMirTarget
Synonyms AKAP 110; AKAP110; CT82; FSP95; HEL159; PRKA3; SOB1
ACCN NM_006422
Insert Size 251 bp
Sequence Data
>SC202828 3’UTR clone of NM_006422
The sequence shown below is from the reference sequence of NM_006422. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGCTGGACTGGCTGATGGTGAACCTGTAATCGGCAACCCCACTGCTTTCCCCTCTTCTGGCAGTGGGG
CCGGCCCTTATCCCCGCCCTTCTTTCTCACTTCCACATCTCCCCCTCTATATCCTCACAGAGCCCTAAC
ATTATCTTCACACCACTCTCATCAAAGACATGTCATCTTGTGCTAGCCACTGGATTTTGCAGATTTTCC
TGTCCATGCAAGCAAGGACGTAAAATTAAAAAATTACAATTAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006422.4
Synonyms AKAP 110; AKAP110; CT82; FSP95; HEL159; PRKA3; SOB1
Summary This gene encodes a member of A-kinase anchoring proteins (AKAPs), a family of functionally related proteins that target protein kinase A to discrete locations within the cell. The encoded protein is reported to participate in protein-protein interactions with the R-subunit of the protein kinase A as well as sperm-associated proteins. This protein is expressed in spermatozoa and localized to the acrosomal region of the sperm head as well as the length of the principal piece. It may function as a regulator of motility, capacitation, and the acrosome reaction. [provided by RefSeq, May 2013]
Locus ID 10566
MW 9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...