Apc5 (ANAPC5) (NM_016237) Human 3' UTR Clone

CAT#: SC202826

3' UTR clone of anaphase promoting complex subunit 5 (ANAPC5) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Apc5 (ANAPC5) (NM_016237) Human 3' UTR Clone
Vector pMirTarget
Synonyms APC5
ACCN NM_016237
Insert Size 265 bp
Sequence Data
>SC202826 3’UTR clone of NM_016237
The sequence shown below is from the reference sequence of NM_016237. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CATGGGGTACCCTTGATAAACCATCTCTAGAGAGGACATCCCTGCTGGGCTGCTGTGCAGAGTATAAGA
TTTTGGACTTGTTCATGTCCCCTCTCTCCCTATAAATGATGTATTTGTGACACCCTATCTTGTCAATAA
ACAGCATTCTGATTAGTTTGTCTTATTTTGTTGCTAGTAACTACGTATTTGTTTTATTCCCCTTTTCTT
CCCTTTTGGTAGCAAAGGACACCAACTTTTTCTTAATAAATGGGTATTTTGCTAACAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_016237.5
Synonyms APC5
Summary This gene encodes a tetratricopeptide repeat-containing component of the anaphase promoting complex/cyclosome (APC/C), a large E3 ubiquitin ligase that controls cell cycle progression by targeting a number of cell cycle regulators such as B-type cyclins for 26S proteasome-mediated degradation through ubiquitination. The encoded protein is required for the proper ubiquitination function of APC/C and for the interaction of APC/C with transcription coactivators. It also interacts with polyA binding protein and represses internal ribosome entry site-mediated translation. Multiple transcript variants encoding different isoforms have been found for this gene. These differences cause translation initiation at a downstream AUG and result in a shorter protein (isoform b), compared to isoform a. [provided by RefSeq, Nov 2008]
Locus ID 51433
MW 10.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...