Mucolipin 1 (MCOLN1) (NM_020533) Human 3' UTR Clone

CAT#: SC202812

3' UTR clone of mucolipin 1 (MCOLN1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CN¥ 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CN¥ 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00

Specifications

Product Data
Product Name Mucolipin 1 (MCOLN1) (NM_020533) Human 3' UTR Clone
Vector pMirTarget
Synonyms MG-2; ML1; ML4; MLIV; MST080; MSTP080; TRP-ML1; TRPM-L1; TRPML1
ACCN NM_020533
Insert Size 244 bp
Sequence Data
>SC202812 3’UTR clone of NM_020533
The sequence shown below is from the reference sequence of NM_020533. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCGGAGGAGCATTCGCTGCTGGTGAATTGATTCGACCTGACTGCCGTTGGACCGTAGGCCCTGGACTGC
AGAGACCCCCGCCCCCGACCCCGCTTATTTATTTGTAGGGTTTGCTTTTAAGGATCGGCTCCCTGTCGC
GCCCGAGGAGGGCCTGGACCTTTCGTGTCGGACCCTTGGGGGCGGGGAGACTGGGTGGGGAGGGTGTTG
AATAAAAGGGAAAATAAATGTGTCGTTTTCATTTTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_020533.3
Synonyms MG-2; ML1; ML4; MLIV; MST080; MSTP080; TRP-ML1; TRPM-L1; TRPML1
Summary This gene encodes a memberof the transient receptor potential (TRP) cation channel gene family. The transmembrane protein localizes to intracellular vesicular membranes including lysosomes, and functions in the late endocytic pathway and in the regulation of lysosomal exocytosis. The channel is permeable to Ca(2+), Fe(2+), Na(+), K(+), and H(+), and is modulated by changes in Ca(2+) concentration. Mutations in this gene result in mucolipidosis type IV. [provided by RefSeq, Oct 2009]
Locus ID 57192
MW 9.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...