CD130 (IL6ST) (NM_002184) Human 3' UTR Clone

CAT#: SC202754

3' UTR clone of interleukin 6 signal transducer (gp130 oncostatin M receptor) (IL6ST) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CD130 (IL6ST) (NM_002184) Human 3' UTR Clone
Vector pMirTarget
Synonyms CD130; CDW130; GP130; HIES4; IL-6RB; sGP130
ACCN NM_002184
Insert Size 232 bp
Sequence Data
>SC202754 3' UTR clone of NM_002184
The sequence shown below is from the reference sequence of NM_002184. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TACCACAGACTGTACGGCAAGGCGGCTACATGCCTCAGTGAAGGACTAGTAGTTCCTGCTACAACTTCAG
CAGTACCTATAAAGTAAAGCTAAAATGATTTTATCTGTGAATTCAGATTTTAAAAAGTCTTCACTCTCTG
AAGATGATCATTTGCCCTTAAGGACAAAAATGAACTGAAGTTTCACATGAGCTATTTCCATTCCAGAATA
TCTGGGATTCTACTTTAAGCAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002184.2
Synonyms CD130; CDW130; GP130; HIES4; IL-6RB; sGP130
Summary The protein encoded by this gene is a signal transducer shared by many cytokines, including interleukin 6 (IL6), ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), and oncostatin M (OSM). This protein functions as a part of the cytokine receptor complex. The activation of this protein is dependent upon the binding of cytokines to their receptors. vIL6, a protein related to IL6 and encoded by the Kaposi sarcoma-associated herpesvirus, can bypass the interleukin 6 receptor (IL6R) and directly activate this protein. Knockout studies in mice suggest that this gene plays a critical role in regulating myocyte apoptosis. Alternatively spliced transcript variants have been described. A related pseudogene has been identified on chromosome 17. [provided by RefSeq, May 2014]
Locus ID 3572
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...