Diazepam Binding Inhibitor (DBI) (NM_020548) Human 3' UTR Clone

CAT#: SC202716

3' UTR clone of diazepam binding inhibitor (GABA receptor modulator acyl-Coenzyme A binding protein) (DBI) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Diazepam Binding Inhibitor (DBI) (NM_020548) Human 3' UTR Clone
Vector pMirTarget
Synonyms ACBD1; ACBP; CCK-RP; EP
ACCN NM_020548
Insert Size 255 bp
Sequence Data
>SC202716 3’UTR clone of NM_020548
The sequence shown below is from the reference sequence of NM_020548. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAAGAGCTAAAGAAAAAATACGGGATATGAGAGACTGGATTTGGTTACTGTGCCATGTGTTTATCCTAA
ACTGAGACAATGCCTTGTTTTTTTCTAATACCGTGGATGGTGGGAATTCGGGAAAATAACCAGTTAAAC
CAGCTACTCAAGGCTGCTCACCATACGGCTCTAACAGATTAGGGGCTAAAACGATTACTGACTTTCCTT
GAGTAGTTTTTATCTGAAATCAATTAAAAGTGTATTTGTTACTTTAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_020548.9
Synonyms ACBD1; ACBP; CCK-RP; EP
Summary This gene encodes diazepam binding inhibitor, a protein that is regulated by hormones and is involved in lipid metabolism and the displacement of beta-carbolines and benzodiazepines, which modulate signal transduction at type A gamma-aminobutyric acid receptors located in brain synapses. The protein is conserved from yeast to mammals, with the most highly conserved domain consisting of seven contiguous residues that constitute the hydrophobic binding site for medium- and long-chain acyl-Coenzyme A esters. Diazepam binding inhibitor is also known to mediate the feedback regulation of pancreatic secretion and the postprandial release of cholecystokinin, in addition to its role as a mediator in corticotropin-dependent adrenal steroidogenesis. Three pseudogenes located on chromosomes 6, 8 and 16 have been identified. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Locus ID 1622
MW 9.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

其它Diazepam Binding Inhibitor产品

Customer Reviews 
Loading...