TINAG (NM_014464) Human 3' UTR Clone

CAT#: SC202687

3' UTR clone of tubulointerstitial nephritis antigen (TINAG) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name TINAG (NM_014464) Human 3' UTR Clone
Vector pMirTarget
Synonyms TIN-AG
ACCN NM_014464
Insert Size 247 bp
Sequence Data
>SC202687 3’UTR clone of NM_014464
The sequence shown below is from the reference sequence of NM_014464. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGCCAACTGACGAGTTCTGATGAACCATAACATATCATTAAATTTCCATAAGGTCATGCCTTTAAGTAA
CCCCCTAAATTGAAGTTTAGCAATATGACATTCTTGGTGACAGTGGAATCTTTGTCTCTTCACCGTGTT
AACATAATCTATCTATTTTCTTATTTTCCCCTCTGGTCTATGCTTCTGCTTCCTTCATATTACTGAGCA
TTAACAACACCAATAAAGGACAGCAGAGTCCCTAAATGTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014464.4
Synonyms TIN-AG
Summary This gene encodes a glycoprotein that is restricted within the kidney to the basement membranes underlying the epithelium of Bowman's capsule and proximal and distal tubules. Autoantibodies against this protein are found in sera of patients with tubulointerstital nephritis, membranous nephropathy and anti-glomerular basement membrane nephritis. Ontogeny studies suggest that the expression of this antigen is developmentally regulated in a precise spatial and temporal pattern throughout nephrogenesis. [provided by RefSeq, Nov 2011]
Locus ID 27283
MW 9.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...