AKT3 (NM_181690) Human 3' UTR Clone

CAT#: SC202650

3' UTR clone of v-akt murine thymoma viral oncogene homolog 3 (protein kinase B gamma) (AKT3) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name AKT3 (NM_181690) Human 3' UTR Clone
Vector pMirTarget
Synonyms MPPH; MPPH2; PKB-GAMMA; PKBG; PRKBG; RAC-gamma; RAC-PK-gamma; STK-2
ACCN NM_181690
Insert Size 254 bp
Sequence Data
>SC202650 3’UTR clone of NM_181690
The sequence shown below is from the reference sequence of NM_181690. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGTGGCATGCTGGGTAACTGGAAAAAATAATAAAAATCGGCTTCCTACAGCCAGCAGCACAGTCACCCA
TGGAACTGTTGGCTTTGGATTAAATGTGGAATTGAACGACTACCCAGAAGTGTTCTGGAAAGAAGCGAG
ATGTGTGGCCTGCCTCACCGTCCTCACCCATCAAAAGCACCAGCAGGCACGTTAACTCGAATTCTCACA
AGGAAAAGGCCATTAAAGCTCAAGGTGCATTTCAAACTCCAGGCTAC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_181690.2
Synonyms MPPH; MPPH2; PKB-GAMMA; PKBG; PRKBG; RAC-gamma; RAC-PK-gamma; STK-2
Summary The protein encoded by this gene is a member of the AKT, also called PKB, serine/threonine protein kinase family. AKT kinases are known to be regulators of cell signaling in response to insulin and growth factors. They are involved in a wide variety of biological processes including cell proliferation, differentiation, apoptosis, tumorigenesis, as well as glycogen synthesis and glucose uptake. This kinase has been shown to be stimulated by platelet-derived growth factor (PDGF), insulin, and insulin-like growth factor 1 (IGF1). Alternatively splice transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Locus ID 10000
MW 9.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...