POLR1C (NM_203290) Human 3' UTR Clone

CAT#: SC202639

3' UTR clone of polymerase (RNA) I polypeptide C 30kDa (POLR1C) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CN¥ 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CN¥ 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00

Specifications

Product Data
Product Name POLR1C (NM_203290) Human 3' UTR Clone
Vector pMirTarget
Synonyms AC40; HLD11; RPA5; RPA39; RPA40; RPAC1; RPC40; TCS3
ACCN NM_203290
Insert Size 243 bp
Sequence Data
>SC202639 3’UTR clone of NM_203290
The sequence shown below is from the reference sequence of NM_203290. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GATGAACTAGATGCGGTTCAGATGGACTGAGCTTGGATGCTTCTGAGGCAAGCTGAAGCTTTGGGTTCT
GACTGACCCACCCTACAGGACTGCTGAACAGAGAGCCCAGTGTGACTAGGGATCCTGAGTTTTCTGGGA
CAATTCCAGCTTTAATCAATACATTTTGTTAAATGTGCCATAAAATGAGACTTTTTACGCCTTTATAAG
GCCTTAGATGTAAATAAACTCACCCAAACAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_203290.4
Synonyms AC40; HLD11; RPA5; RPA39; RPA40; RPAC1; RPC40; TCS3
Summary The protein encoded by this gene is a subunit of both RNA polymerase I and RNA polymerase III complexes. The encoded protein is part of the Pol core element. Mutations in this gene have been associated with Treacher Collins syndrome (TCS) and hypomyelinating leukodystrophy 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Locus ID 9533
MW 9.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...