Vitamin D Binding protein (GC) (NM_000583) Human 3' UTR Clone

CAT#: SC202623

3' UTR clone of group-specific component (vitamin D binding protein) (GC) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Vitamin D Binding protein (GC) (NM_000583) Human 3' UTR Clone
Vector pMirTarget
Synonyms DBP; DBP-maf; DBP/GC; Gc-MAF; GcMAF; GRD3; HEL-S-51; VDB; VDBG; VDBP
ACCN NM_000583
Insert Size 216 bp
Sequence Data
>SC202623 3' UTR clone of NM_000583
The sequence shown below is from the reference sequence of NM_000583. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTGTGATTCAGAGATTGATGCTGAATTGAAGAATATCCTGTAGTCCTGAAGCATGTTTATTAACTTTGAC
CAGAGTTGGAGCCACCCAGGGGAATGATCTCTGATGACCTAACCTAAGCAAAACCACTGAGCTTCTGGGA
AGACAACTAGGATACTTTCTACTTTTTCTAGCTACAATATCTTCATACAATGACAAGTATGATGATTTGC
TATCAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000583.2
Synonyms DBP; DBP-maf; DBP/GC; Gc-MAF; GcMAF; GRD3; HEL-S-51; VDB; VDBG; VDBP
Summary The protein encoded by this gene belongs to the albumin gene family. It is a multifunctional protein found in plasma, ascitic fluid, cerebrospinal fluid and on the surface of many cell types. It binds to vitamin D and its plasma metabolites and transports them to target tissues. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2011]
Locus ID 2638
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...