alpha Tubulin (TUBA1A) (NM_006009) Human 3' UTR Clone

CAT#: SC202606

3' UTR clone of tubulin alpha 1a (TUBA1A) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name alpha Tubulin (TUBA1A) (NM_006009) Human 3' UTR Clone
Vector pMirTarget
Synonyms B-ALPHA-1; LIS3; TUBA3
ACCN NM_006009
Insert Size 245 bp
Sequence Data
>SC202606 3’UTR clone of NM_006009
The sequence shown below is from the reference sequence of NM_006009. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGGGTGAGGAAGAAGGAGAGGAATACTAAAGTTAAAACGTCACAAAGGTGCTGCTTTTACAGGGAAGC
TTATTCTGTTTTAAACATTGAAAAGTTGTGGTCTGATCAGTTAATTTGTATGTAGCAGTGTATGCTCTC
ATATACAATTACTGACCTATGCTCTAAAACATGAATGCTTTGTTACAGACCCAAGCTGTCCATTTCTGT
GATGGGTTTTGAATAAAGTATTCCCTGTCTTAAATGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006009.4
Synonyms B-ALPHA-1; LIS3; TUBA3
Summary Microtubules of the eukaryotic cytoskeleton perform essential and diverse functions and are composed of a heterodimer of alpha and beta tubulins. The genes encoding these microtubule constituents belong to the tubulin superfamily, which is composed of six distinct families. Genes from the alpha, beta and gamma tubulin families are found in all eukaryotes. The alpha and beta tubulins represent the major components of microtubules, while gamma tubulin plays a critical role in the nucleation of microtubule assembly. There are multiple alpha and beta tubulin genes, which are highly conserved among species. This gene encodes alpha tubulin and is highly similar to the mouse and rat Tuba1 genes. Northern blot studies have shown that the gene expression is predominantly found in morphologically differentiated neurologic cells. This gene is one of three alpha-tubulin genes in a cluster on chromosome 12q. Mutations in this gene cause lissencephaly type 3 (LIS3) - a neurological condition characterized by microcephaly, intellectual disability, and early-onset epilepsy caused by defective neuronal migration. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2017]
Locus ID 7846
MW 9.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...