POLR1H (NM_014596) Human 3' UTR Clone

CAT#: SC202576

3' UTR clone of zinc ribbon domain containing 1 (ZNRD1) transcript variant b for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CN¥ 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CN¥ 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00

Specifications

Product Data
Product Name POLR1H (NM_014596) Human 3' UTR Clone
Vector pMirTarget
Synonyms A12.2; HTEX-6; HTEX6; hZR14; Rpa12; tctex-6; TCTEX6; TEX6; ZNRD1; ZR14
ACCN NM_014596
Insert Size 240 bp
Sequence Data
>SC202576 3’UTR clone of NM_014596
The sequence shown below is from the reference sequence of NM_014596. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGCAAGTTCCAGGAGAAGGAAGACTCTTGACCTTTTTCCTGGGCAACTCTACAGTCCCTCCCTCCTTTC
GGAAGGTGAAGGATACTGGGTTTTTAGATGCCTTGTCCATCCTGTCTGGTTGCAATGTTTTGCTCCCAG
AAGAGAATCAGATCATCATGTGGGGATTACCATTGTTCCTGGAGTACTCCTACCCTTAGTTGAATTTCC
TTATTAAAGTTATATTTTTCTATAAGACCCTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014596.6
Synonyms A12.2; HTEX-6; HTEX6; hZR14; Rpa12; tctex-6; TCTEX6; TEX6; ZNRD1; ZR14
Summary This gene encodes a DNA-directed RNA polymerase I subunit. The encoded protein contains two potential zinc-binding motifs and may play a role in regulation of cell proliferation. The encoded protein may be involved in cancer and human immunodeficiency virus progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Locus ID 30834
MW 9.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...