IL11RA (NM_147162) Human 3' UTR Clone

CAT#: SC202573

3' UTR clone of interleukin 11 receptor alpha (IL11RA) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name IL11RA (NM_147162) Human 3' UTR Clone
Vector pMirTarget
Synonyms CRSDA
ACCN NM_147162
Insert Size 250 bp
Sequence Data
>SC202573 3’UTR clone of NM_147162
The sequence shown below is from the reference sequence of NM_147162. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCTGGGGCCCTGGCACTGGGGCTCTGGTAAGTGACTGCCATTGGTCCCTCAGCCTCTGATCCTCACACA
TGCTCTGATGCCCATAGACCACATTCATCTCCACCCTTCATGACTGCCCGCTGAACCTGTCTGATTCTG
GAACTACCTCCCCATACCTCCATCCCCCATGCCCCACTTGATTTTAACTGATTCCTCTCCTGACCCTTT
ACTAATAAACCCTTTGGCGGAGACTGAGATAACCCACAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_147162.1
Synonyms CRSDA
Summary Interleukin 11 is a stromal cell-derived cytokine that belongs to a family of pleiotropic and redundant cytokines that use the gp130 transducing subunit in their high affinity receptors. This gene encodes the IL-11 receptor, which is a member of the hematopoietic cytokine receptor family. This particular receptor is very similar to ciliary neurotrophic factor, since both contain an extracellular region with a 2-domain structure composed of an immunoglobulin-like domain and a cytokine receptor-like domain. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2012]
Locus ID 3590
MW 8.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...