HAGH (NM_001040427) Human 3' UTR Clone

CAT#: SC202538

3' UTR clone of hydroxyacylglutathione hydrolase (HAGH) nuclear gene encoding mitochondrial protein transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name HAGH (NM_001040427) Human 3' UTR Clone
Vector pMirTarget
Synonyms GLO2; GLX2; GLXII; HAGH1
ACCN NM_001040427
Insert Size 186 bp
Sequence Data
>SC202538 3' UTR clone of NM_001040427
The sequence shown below is from the reference sequence of NM_001040427. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGGACCAGTTCAAGATGCCCCGGGACTGAGGCCGCCCTGCACCTTCAGCGGATTTGGGGATTAGGCTCTT
TTAGGTAACTGGCTTTCCTGCTGGTCCGTGCGGGAAATTCAGTCTTGATTTAACCTTAATTTTACAGCCC
TTGGCTTGTGTTATCGGACATTCTAATGCATATTTATAAGAGAAGT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001040427.1
Synonyms GLO2; GLX2; GLXII; HAGH1
Summary The enzyme encoded by this gene is classified as a thiolesterase and is responsible for the hydrolysis of S-lactoyl-glutathione to reduced glutathione and D-lactate. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2013]
Locus ID 3029
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...