PLAAT4 (NM_004585) Human 3' UTR Clone

CAT#: SC202500

3' UTR clone of retinoic acid receptor responder (tazarotene induced) 3 (RARRES3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PLAAT4 (NM_004585) Human 3' UTR Clone
Vector pMirTarget
Synonyms HRASLS4; HRSL4; PLA1/2-3; PLAAT-4; RARRES3; RIG1; TIG3
ACCN NM_004585
Insert Size 232 bp
Sequence Data
>SC202500 3’UTR clone of NM_004585
The sequence shown below is from the reference sequence of NM_004585. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGGAGATACCAAAAAAAAGCGACAGCCTGAAGCAGCCACAAAATCCTGTGTTAGAAGCAGCTGTGGGGG
TCCCAGTGGAGATGAGCCTCCCCCATGCCTCCAGCAGCCTGACCCTCGTGCCCTGTCTCAGGCGTTCTC
TAGATCCTTTCCTCTGTTTCCCTCTCTCGCTGGCAAAAGTATGATCTAATTGAAACAAGACTGAAGGAT
CAATAAACAGCCATCTGCCCCTTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004585.5
Synonyms HRASLS4; HRSL4; PLA1/2-3; PLAAT-4; RARRES3; RIG1; TIG3
Summary Retinoids exert biologic effects such as potent growth inhibitory and cell differentiation activities and are used in the treatment of hyperproliferative dermatological diseases. These effects are mediated by specific nuclear receptor proteins that are members of the steroid and thyroid hormone receptor superfamily of transcriptional regulators. RARRES1, RARRES2, and RARRES3 are genes whose expression is upregulated by the synthetic retinoid tazarotene. RARRES3 is thought act as a tumor suppressor or growth regulator. [provided by RefSeq, Jul 2008]
Locus ID 5920
MW 8.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...