Factor I (CFI) (NM_000204) Human 3' UTR Clone

CAT#: SC202412

3' UTR clone of complement factor I (CFI) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Factor I (CFI) (NM_000204) Human 3' UTR Clone
Vector pMirTarget
Synonyms AHUS3; ARMD13; C3b-INA; C3BINA; FI; IF; KAF
ACCN NM_000204
Insert Size 228 bp
Sequence Data
>SC202412 3’UTR clone of NM_000204
The sequence shown below is from the reference sequence of NM_000204. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGGCCTTTTATTTCTCAGTACAATGTATAAAATTGTGATCTCTCTCTTCATTCTATTCTTTTTCTCTCA
AGAGTTCCATTTAATGGAAATAAAACGGTATAATTAATAATTCTCTAGGGGGGAAAAATGAAGCAAATC
TCACTGGATATTTTTAAAGGTCTCCACAGAGTTTATGCCATATTGGAATTTTGTTGTATAATTCTCAAA
TAAATATTTTGGTGAAGCATA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000204.5
Synonyms AHUS3; ARMD13; C3b-INA; C3BINA; FI; IF; KAF
Summary This gene encodes a serine proteinase that is essential for regulating the complement cascade. The encoded preproprotein is cleaved to produce both heavy and light chains, which are linked by disulfide bonds to form a heterodimeric glycoprotein. This heterodimer can cleave and inactivate the complement components C4b and C3b, and it prevents the assembly of the C3 and C5 convertase enzymes. Defects in this gene cause complement factor I deficiency, an autosomal recessive disease associated with a susceptibility to pyogenic infections. Mutations in this gene have been associated with a predisposition to atypical hemolytic uremic syndrome, a disease characterized by acute renal failure, microangiopathic hemolytic anemia and thrombocytopenia. Primary glomerulonephritis with immune deposits and age-related macular degeneration are other conditions associated with mutations of this gene. [provided by RefSeq, Dec 2015]
Locus ID 3426
MW 8.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...