RAD54 (RAD54L) (NM_003579) Human 3' UTR Clone

CAT#: SC202377

3' UTR clone of RAD54-like (S. cerevisiae) (RAD54L) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 5,464.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name RAD54 (RAD54L) (NM_003579) Human 3' UTR Clone
Vector pMirTarget
Synonyms hHR54; HR54; hRAD54; RAD54A
ACCN NM_003579
Insert Size 221 bp
Sequence Data
>SC202377 3’UTR clone of NM_003579
The sequence shown below is from the reference sequence of NM_003579. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCTCATGAGGAGCAGCGGGGCCTCCGCTGATAACCAGCTGGTCTGGGTGTAGCTCTTAGAGGAAGGAGA
TAGGGAAAAGGGGCTCCTTGCTCCACAGGGCCCTGTTGAATTTTGTTCTCTGGGAGAAAATCATCAAGA
AGGGCTGCATGATGTTTGCCCAAAATTTATTTTATAAGAAAAACTTTTTTGGTTAAAAAAAAGAATAAA
GGTATGAAAGGGTT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003579.4
Synonyms hHR54; HR54; hRAD54; RAD54A
Summary The protein encoded by this gene belongs to the DEAD-like helicase superfamily, and shares similarity with Saccharomyces cerevisiae Rad54, a protein known to be involved in the homologous recombination and repair of DNA. This protein has been shown to play a role in homologous recombination related repair of DNA double-strand breaks. The binding of this protein to double-strand DNA induces a DNA topological change, which is thought to facilitate homologous DNA paring, and stimulate DNA recombination. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Dec 2008]
Locus ID 8438
MW 8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...