PR3 (PRTN3) (NM_002777) Human 3' UTR Clone

CAT#: SC202337

3' UTR clone of proteinase 3 (PRTN3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CN¥ 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CN¥ 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00

Specifications

Product Data
Product Name PR3 (PRTN3) (NM_002777) Human 3' UTR Clone
Vector pMirTarget
Synonyms ACPA; AGP7; C-ANCA; CANCA; MBN; MBT; NP-4; NP4; P29; PR-3; PR3
ACCN NM_002777
Insert Size 236 bp
Sequence Data
>SC202337 3’UTR clone of NM_002777
The sequence shown below is from the reference sequence of NM_002777. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGCCGTGTGGAGGCCAAGGGCCGCCCCTGAACCGCCCCTCCCACAGCGCTGGCCGGGACCCCGAGCCTG
GCTCCAAACCCTCGAGGCGGATCTTTGGACAGAAGCAGCTCTTCCCCGAACACTGTGGCGTCCGGGACG
GCCCCACCCGTCCCCCCACACTCCCTCCCACGGGGCTCCGGGAGACAGGCCGGCCCTGCACCTCACCCC
ACCGTGACCTCAATAAACGTTGAAACTCC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002777.4
Synonyms ACPA; AGP7; C-ANCA; CANCA; MBN; MBT; NP-4; NP4; P29; PR-3; PR3
Summary Serine protease that degrades elastin, fibronectin, laminin, vitronectin, and collagen types I, III, and IV (in vitro) (PubMed:3198760, PubMed:2033050, PubMed:28240246). By cleaving and activating receptor F2RL1/PAR-2, enhances endothelial cell barrier function and thus vascular integrity during neutrophil transendothelial migration (PubMed:23202369). May play a role in neutrophil transendothelial migration, probably when associated with CD177 (PubMed:22266279).[UniProtKB/Swiss-Prot Function]
Locus ID 5657
MW 7.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...