SEPTIN4 (NM_080416) Human 3' UTR Clone

CAT#: SC202285

3' UTR clone of septin 4 (SEPT4) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name SEPTIN4 (NM_080416) Human 3' UTR Clone
Vector pMirTarget
Synonyms ARTS; BRADEION; C17orf47; CE5B3; H5; hCDCREL-2; hucep-7; MART; PNUTL2; SEP4; SEPT4
ACCN NM_080416
Insert Size 200 bp
Sequence Data
>SC202285 3’UTR clone of NM_080416
The sequence shown below is from the reference sequence of NM_080416. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATACAAAAACAGATGAAGGAGAACTATTAACTGGCTTTCAGCCCTGGATATTTAAATCTCCTCCTCTTC
TTCCTGTCCATGCCGGCCCCTCCCAGCACCAGCTCTGCTCAGGCCCCTTCAGCTACTGCCACTTCGCCT
TACATCCCTGCTGACTGCCCAGAGACTCAGAGGAAATAAAGTTTAATAAATCTGTAGGTGGC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_080416.4
Synonyms ARTS; BRADEION; C17orf47; CE5B3; H5; hCDCREL-2; hucep-7; MART; PNUTL2; SEP4; SEPT4
Summary This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer. [provided by RefSeq, Nov 2010]
Locus ID 5414
MW 7.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...