DAXX (NM_001141969) Human 3' UTR Clone

CAT#: SC202282

3' UTR clone of death-domain associated protein (DAXX) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name DAXX (NM_001141969) Human 3' UTR Clone
Vector pMirTarget
Synonyms BING2; DAP6; EAP1; SMIM40
ACCN NM_001141969
Insert Size 215 bp
Sequence Data
>SC202282 3’UTR clone of NM_001141969
The sequence shown below is from the reference sequence of NM_001141969. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGATCATCGTGCTCTCAGACTCTGATTAGCTGCCTCCCCTTCTCCCTGCCTCCAGAATGTTCTGGGAT
AACATTTGGAGGAAGGTGGGAAGCAGATGACTGAGGAAGGGATGGACTAAGCTAATCCCCTTTTGGTGG
TGTTTCTTTAAAAAAAAAAAAAAGCTTAAGTTTTACACAGAAACATTAATAAACAATAAAGTTCTTTTC
TTACTGTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001141969.2
Synonyms BING2; DAP6; EAP1; SMIM40
Summary This gene encodes a multifunctional protein that resides in multiple locations in the nucleus and in the cytoplasm. It interacts with a wide variety of proteins, such as apoptosis antigen Fas, centromere protein C, and transcription factor erythroblastosis virus E26 oncogene homolog 1. In the nucleus, the encoded protein functions as a potent transcription repressor that binds to sumoylated transcription factors. Its repression can be relieved by the sequestration of this protein into promyelocytic leukemia nuclear bodies or nucleoli. This protein also associates with centromeres in G2 phase. In the cytoplasm, the encoded protein may function to regulate apoptosis. The subcellular localization and function of this protein are modulated by post-translational modifications, including sumoylation, phosphorylation and polyubiquitination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2008]
Locus ID 1616
MW 8.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...