VPS16 (NM_022575) Human 3' UTR Clone

CAT#: SC202262

3' UTR clone of vacuolar protein sorting 16 homolog (S. cerevisiae) (VPS16) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name VPS16 (NM_022575) Human 3' UTR Clone
Vector pMirTarget
Synonyms DYT30; hVPS16
ACCN NM_022575
Insert Size 188 bp
Sequence Data
>SC202262 3’UTR clone of NM_022575
The sequence shown below is from the reference sequence of NM_022575. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGGGCCAGGGCACAAGCCCAGAAGAAGTGAGGAGTCCATCCTGTACATCTCAAGCAAGGGGTTCCTCCC
CTAGCACCTGGGCTTGGCAGAAGGGCCATAGTTCATCCAGCTCCTCCCCTAGAGCAATGCTGAGGAGCG
GGGGCATGGTAGCAGGGCTGTCTGGTTTTAAATAAAGTTGGAACACTTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_022575.4
Synonyms DYT30; hVPS16
Summary Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
Locus ID 64601
MW 6.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...