TEAD4 (NM_201443) Human 3' UTR Clone

CAT#: SC202254

3' UTR clone of TEA domain family member 4 (TEAD4) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name TEAD4 (NM_201443) Human 3' UTR Clone
Vector pMirTarget
Synonyms EFTR-2; hRTEF-1B; RTEF1; TCF13L1; TEF-3; TEF3; TEFR-1
ACCN NM_201443
Insert Size 228 bp
Sequence Data
>SC202254 3’UTR clone of NM_201443
The sequence shown below is from the reference sequence of NM_201443. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CACCACATCTACAGGCTGGTGAAAGAATGAGAGACTCGGGGAGCAGGGAGGGGGGAAGAGACGTGTGTG
CAGGAAACGGGGACGTGGGGAGGGGACCTGCAGGGGCAGCCCCCTGAAGTGCCAAGAGAGCTGAGAGGA
GCAGTTGTGACTCTACCCAGGAACAAACTGTGCCTGAACCTGAGGTGCCCAACCCCAAATAAACCCAAG
ATGCTGTGTATTTTCAGAGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_201443.3
Synonyms EFTR-2; hRTEF-1B; RTEF1; TCF13L1; TEF-3; TEF3; TEFR-1
Summary This gene product is a member of the transcriptional enhancer factor (TEF) family of transcription factors, which contain the TEA/ATTS DNA-binding domain. It is preferentially expressed in the skeletal muscle, and binds to the M-CAT regulatory element found in promoters of muscle-specific genes to direct their gene expression. Alternatively spliced transcripts encoding distinct isoforms, some of which are translated through the use of a non-AUG (UUG) initiation codon, have been described for this gene. [provided by RefSeq, Jul 2008]
Locus ID 7004
MW 8.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...