EIF4EL3 (EIF4E2) (NM_004846) Human 3' UTR Clone

CAT#: SC202193

3' UTR clone of eukaryotic translation initiation factor 4E family member 2 (EIF4E2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name EIF4EL3 (EIF4E2) (NM_004846) Human 3' UTR Clone
Vector pMirTarget
Synonyms 4E-LP; 4EHP; EIF4EL3; h4EHP; IF4e
ACCN NM_004846
Insert Size 223 bp
Sequence Data
>SC202193 3’UTR clone of NM_004846
The sequence shown below is from the reference sequence of NM_004846. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTCTGGAAGCCGCGGTTGAATGTGCCATGACCCTCTCCCTCTCTGGATGGCACCATCATTGAAGCTGGC
GTCATCGGAGTCTCTTGTTCTGTTGGCGTGCTACCTGGAAGATCCTTCTGTCCTGGACAAGAGGAATTG
GAAGAGCATTTTATGTTTTAAGAACAGGCTGACACGCAGCAGCTACAACAACAGCTGAGATCACTTAAT
AAATGGTGCTAAACTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004846.4
Synonyms 4E-LP; 4EHP; EIF4EL3; h4EHP; IF4e
Summary Recognizes and binds the 7-methylguanosine-containing mRNA cap during an early step in the initiation (PubMed:9582349, PubMed:17368478, PubMed:25624349). Acts as a repressor of translation initiation (PubMed:22751931). In contrast to EIF4E, it is unable to bind eIF4G (EIF4G1, EIF4G2 or EIF4G3), suggesting that it acts by competing with EIF4E and block assembly of eIF4F at the cap (By similarity).[UniProtKB/Swiss-Prot Function]
Locus ID 9470
MW 8.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...