NDUFA8 (NM_014222) Human 3' UTR Clone

CAT#: SC202180

3' UTR clone of NADH dehydrogenase (ubiquinone) 1 alpha subcomplex8 19kDa (NDUFA8) nuclear gene encoding mitochondrial protein for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name NDUFA8 (NM_014222) Human 3' UTR Clone
Vector pMirTarget
Synonyms CI-19KD; CI-PGIV; MC1DN37; PGIV
ACCN NM_014222
Insert Size 184 bp
Sequence Data
>SC202180 3' UTR clone of NM_014222
The sequence shown below is from the reference sequence of NM_014222. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCCGCTTTTATTTCTGGACCAAGTAAAGATGGGTCCGTGGCCCACACTCGGTCATGTGCTCAGACAACGA
CTGATGAAAACGCCCATGCGGTTTGCATCGACTGATAGTGTGTTCTTTCCGGGATCACAAACATTAACAA
AAAAGTTAACTTATGTGACTTGGCAGTTATTCTATACCATTTCC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014222.2
Synonyms CI-19KD; CI-PGIV; MC1DN37; PGIV
Summary The protein encoded by this gene belongs to the complex I 19 kDa subunit family. Mammalian complex I is composed of 45 different subunits. This protein has NADH dehydrogenase activity and oxidoreductase activity. It plays an important role in transfering electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Locus ID 4702
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...