GNMT (NM_018960) Human 3' UTR Clone

CAT#: SC202165

3' UTR clone of glycine N-methyltransferase (GNMT) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name GNMT (NM_018960) Human 3' UTR Clone
Vector pMirTarget
Synonyms HEL-S-182mP
ACCN NM_018960
Insert Size 204 bp
Sequence Data
>SC202165 3’UTR clone of NM_018960
The sequence shown below is from the reference sequence of NM_018960. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTCATCCACGTGCTCAAGAGGACAGACTGAGTGTGGCCTCAGCTCCCACAAGCCTCTGCCCAGGCACTG
CTAGGCTCTGTCTGGAAGATGGGGACCAGCAGCCCCACACCAGGGCCAGCCTCTAGAGCAGACTACAGC
TGGGGTGCAGGGATGTGGGTTCCACAGACGGAAGGGTAAACAATATAGTCTTTTTCAGTTCCTGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_018960.6
Synonyms HEL-S-182mP
Summary The protein encoded by this gene is an enzyme that catalyzes the conversion of S-adenosyl-L-methionine (along with glycine) to S-adenosyl-L-homocysteine and sarcosine. This protein is found in the cytoplasm and acts as a homotetramer. Defects in this gene are a cause of GNMT deficiency (hypermethioninemia). Alternative splicing results in multiple transcript variants. Naturally occurring readthrough transcription occurs between the upstream CNPY3 (canopy FGF signaling regulator 3) gene and this gene and is represented with GeneID:107080644. [provided by RefSeq, Jan 2016]
Locus ID 27232
MW 7.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...