NME2 (NM_001018137) Human 3' UTR Clone

CAT#: SC202127

3' UTR clone of non-metastatic cells 2 protein (NM23B) expressed in (NME2) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name NME2 (NM_001018137) Human 3' UTR Clone
Vector pMirTarget
Synonyms NDKB; NDPK-B; NDPKB; NM23-H2; NM23B; PUF
ACCN NM_001018137
Insert Size 170 bp
Sequence Data
>SC202127 3’UTR clone of NM_001018137
The sequence shown below is from the reference sequence of NM_001018137. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCTTGTGCTCATGACTGGGTCTATGAATAAGAGGTGGACACAACAGCAGTCTCCTTCAGCACGGCGTGG
TGTGTCCCTGGACACAGCTCTTCATTCCATTGACTTAGAGGCAACAGGATTGATCATTCTTTTATAGAG
CATATTTGCCAATAAAGCTTTTGGAAGCCGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001018137.3
Synonyms NDKB; NDPK-B; NDPKB; NM23-H2; NM23B; PUF
Summary Nucleoside diphosphate kinase (NDK) exists as a hexamer composed of 'A' (encoded by NME1) and 'B' (encoded by this gene) isoforms. Multiple alternatively spliced transcript variants have been found for this gene. Read-through transcription from the neighboring upstream gene (NME1) generates naturally-occurring transcripts (NME1-NME2) that encode a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Nov 2010]
Locus ID 4831
MW 6.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...