Troponin C1 (TNNC1) (NM_003280) Human 3' UTR Clone

CAT#: SC202092

3' UTR clone of troponin C type 1 (slow) (TNNC1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Troponin C1 (TNNC1) (NM_003280) Human 3' UTR Clone
Vector pMirTarget
Synonyms CMD1Z; CMH13; TN-C; TNC; TNNC
ACCN NM_003280
Insert Size 205 bp
Sequence Data
>SC202092 3’UTR clone of NM_003280
The sequence shown below is from the reference sequence of NM_003280. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTCCTGGAGTTCATGAAGGGTGTGGAGTAGATGCTGACCTTCACCCAGAGCTGCCTATGCCCAGCCTCC
AACTCCAGCTGAGTCCTGGGGTTGGGGAGGGGGTCGGGGTCCCAGGACCTGAGCCTGGCCATGTCCTCA
ACCCCAAATCCCCCGACTCCCTCCCCAGATCTGTCCTGGGGGATGCAAATAAAGCCTGCTCTCCCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003280.3
Synonyms CMD1Z; CMH13; TN-C; TNC; TNNC
Summary Troponin is a central regulatory protein of striated muscle contraction, and together with tropomyosin, is located on the actin filament. Troponin consists of 3 subunits: TnI, which is the inhibitor of actomyosin ATPase; TnT, which contains the binding site for tropomyosin; and TnC, the protein encoded by this gene. The binding of calcium to TnC abolishes the inhibitory action of TnI, thus allowing the interaction of actin with myosin, the hydrolysis of ATP, and the generation of tension. Mutations in this gene are associated with cardiomyopathy dilated type 1Z. [provided by RefSeq, Oct 2008]
Locus ID 7134
MW 7.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...