PRPF8 (NM_006445) Human 3' UTR Clone

CAT#: SC202054

3' UTR clone of PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) (PRPF8) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PRPF8 (NM_006445) Human 3' UTR Clone
Vector pMirTarget
Synonyms HPRP8; PRP8; PRPC8; RP13; SNRNP220
ACCN NM_006445
Insert Size 203 bp
Sequence Data
>SC202054 3’UTR clone of NM_006445
The sequence shown below is from the reference sequence of NM_006445. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCTGCGGATCGGGAGGACCTGTATGCCTGACCGTTTCCCTGCCTCCTGCTTCAGCCTCCCGAGGCCGAA
GCCTCAGCCCCTCCAGACAGGCCGCTGACATTCAGCAGTTTGGCCTCTTTCCCTCTGTCTGTGCTTGTG
TTGTTGACCTCCTGATGGCTTGTCATCCTGAATAAAATATAATAATAAATTTTGTATAAATAGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006445.4
Synonyms HPRP8; PRP8; PRPC8; RP13; SNRNP220
Summary Pre-mRNA splicing occurs in 2 sequential transesterification steps. The protein encoded by this gene is a component of both U2- and U12-dependent spliceosomes, and found to be essential for the catalytic step II in pre-mRNA splicing process. It contains several WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp8 protein. This gene is a candidate gene for autosomal dominant retinitis pigmentosa. [provided by RefSeq, Jul 2008]
Locus ID 10594
MW 7.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...