AGR3 (NM_176813) Human 3' UTR Clone

CAT#: SC202031

3' UTR clone of anterior gradient homolog 3 (Xenopus laevis) (AGR3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name AGR3 (NM_176813) Human 3' UTR Clone
Vector pMirTarget
Synonyms AG-3; AG3; BCMP11; hAG-3; HAG3; PDIA18
ACCN NM_176813
Insert Size 200 bp
Sequence Data
>SC202031 3’UTR clone of NM_176813
The sequence shown below is from the reference sequence of NM_176813. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCATTAAGACTTATTCAGTCAGAGCTATAAGAGATGATGGAAAAAAGCCTTCACTTCAAAGAAGTCAAA
TTTCATGAAGAAAACCTCTGGCACATTGACAAATACTAAATGTGCAAGTATATAGATTTTGTAATATTA
CTATTTAGTTTTTTTAATGTGTTTGCAATAGTCTTATTAAAATAAATGTTTTTTAAATCTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_176813.5
Synonyms AG-3; AG3; BCMP11; hAG-3; HAG3; PDIA18
Summary This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, a catalytically active thioredoxin domain, and a C-terminal ER-retention sequence. This gene is expressed in ciliated airway epithelial cells and, in mouse, plays a role in ciliary beat frequency in multiciliated cells. This gene is also over-expressed in breast, ovarian, and prostrate cancers. [provided by RefSeq, Dec 2016]
Locus ID 155465
MW 8.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...