Iduronate 2 sulfatase (IDS) (NM_006123) Human 3' UTR Clone

CAT#: SC202029

3' UTR clone of iduronate 2-sulfatase (IDS) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Iduronate 2 sulfatase (IDS) (NM_006123) Human 3' UTR Clone
Vector pMirTarget
Synonyms ID2S; MPS2; SIDS
ACCN NM_006123
Insert Size 187 bp
Sequence Data
>SC202029 3’UTR clone of NM_006123
The sequence shown below is from the reference sequence of NM_006123. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CATGGTTTCCTCATGAGGACAAATACCTGATTTTGAATAAAGCAGCATTCAGTTGAAATAACCCTTTCT
GTGGTAATTCCAAGTGAATATTTTTCTTCTAGGTGATGAGTTTCTACTTCCTCTGGTTTTTACAACAGG
AAATGAAATGGTATCTAAAATAAACAAGCTGTGGTATGATGATTATTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006123.5
Synonyms ID2S; MPS2; SIDS
Summary This gene encodes a member of the sulfatase family of proteins. The encoded preproprotein is proteolytically processed to generate two polypeptide chains. This enzyme is involved in the lysosomal degradation of heparan sulfate and dermatan sulfate. Mutations in this gene are associated with the X-linked lysosomal storage disease mucopolysaccharidosis type II, also known as Hunter syndrome. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]
Locus ID 3423
MW 7.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...