ALG5 (NM_001142364) Human 3' UTR Clone

CAT#: SC201973

3' UTR clone of asparagine-linked glycosylation 5 dolichyl-phosphate beta-glucosyltransferase homolog (S. cerevisiae) (ALG5) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ALG5 (NM_001142364) Human 3' UTR Clone
Vector pMirTarget
Synonyms bA421P11.2
ACCN NM_001142364
Insert Size 178 bp
Sequence Data
>SC201973 3' UTR clone of NM_001142364
The sequence shown below is from the reference sequence of NM_001142364. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGAGGCTTGAGCAAACTCGGAAAATGAATTAGGTTGTTTGCAGTCTTCAGTTGTGTTCTTATGCTTCAGT
GTCACATTTCATTTCATTTGAAACTAAAATTTTAAGTAAAGCTGAAATAAACTTCTTGTCATTGTCTGCC
TTTTGATAATTTTAAAGAAATAACTTTCCATAAGTAAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001142364.1
Synonyms bA421P11.2
Summary This gene encodes a member of the glycosyltransferase 2 family. The encoded protein participates in glucosylation of the oligomannose core in N-linked glycosylation of proteins. The addition of glucose residues to the oligomannose core is necessary to ensure substrate recognition, and therefore, effectual transfer of the oligomannose core to the nascent glycoproteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
Locus ID 29880
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...