ELMO3 (NM_024712) Human 3' UTR Clone

CAT#: SC201951

3' UTR clone of engulfment and cell motility 3 (ELMO3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ELMO3 (NM_024712) Human 3' UTR Clone
Vector pMirTarget
Synonyms CED-12; CED12; ELMO-3
ACCN NM_024712
Insert Size 157 bp
Sequence Data
>SC201951 3’UTR clone of NM_024712
The sequence shown below is from the reference sequence of NM_024712. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGCTATGACTGCAGCATCGCTGAACCTTGACAGTGTGGCTGGCCATGGGCCACAGCTGCGGCCACTGCA
GCAGCCATGAAGGGCAGTGGGTAGAGGAGTGCAGGCACCCTGACCAGCAGAGATTGCTGCAGAAATAAA
GTCTGCTTGGCTCTTGGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_024712.5
Synonyms CED-12; CED12; ELMO-3
Summary The protein encoded by this gene is similar to a C. elegans protein that functions in phagocytosis of apoptotic cells and in cell migration. Other members of this small family of engulfment and cell motility (ELMO) proteins have been shown to interact with the dedicator of cyto-kinesis 1 protein to promote phagocytosis and effect cell shape changes. [provided by RefSeq, Jul 2008]
Locus ID 79767
MW 5.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...