GCAT (NM_014291) Human 3' UTR Clone

CAT#: SC201916

3' UTR clone of glycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme A ligase) (GCAT) nuclear gene encoding mitochondrial protein for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CN¥ 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CN¥ 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00

Specifications

Product Data
Product Name GCAT (NM_014291) Human 3' UTR Clone
Vector pMirTarget
Synonyms KBL
ACCN NM_014291
Insert Size 197 bp
Sequence Data
>SC201916 3' UTR clone of NM_014291
The sequence shown below is from the reference sequence of NM_014291. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGAGGCCTTCGTGGAAGTGGGGCGACTGCACGGGGCACTGCCCTGAGCTCTGGGTAAGGACGAGAAGAGC
CAAGGTCCGCCTACTGCCACAGGGTCAAAGGAGGTTTTCGATCAGCCCAGACCAGAGGCTCTGAGCCCTG
AACCAAAGTCCCAGAGCTGGGCTGGGACGTGACCTGTGCTGAGGGCTGTGAGAATGT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014291.3
Synonyms KBL
Summary The degradation of L-threonine to glycine consists of a two-step biochemical pathway involving the enzymes L-threonine dehydrogenase and 2-amino-3-ketobutyrate coenzyme A ligase. L-Threonine is first converted into 2-amino-3-ketobutyrate by L-threonine dehydrogenase. This gene encodes the second enzyme in this pathway, which then catalyzes the reaction between 2-amino-3-ketobutyrate and coenzyme A to form glycine and acetyl-CoA. The encoded enzyme is considered a class II pyridoxal-phosphate-dependent aminotransferase. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 14. [provided by RefSeq, Jan 2010]
Locus ID 23464
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...