PKMYT1 (NM_004203) Human 3' UTR Clone

CAT#: SC201876

3' UTR clone of protein kinase membrane associated tyrosine/threonine 1 (PKMYT1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PKMYT1 (NM_004203) Human 3' UTR Clone
Vector pMirTarget
Synonyms MYT1; PPP1R126
ACCN NM_004203
Insert Size 175 bp
Sequence Data
>SC201876 3’UTR clone of NM_004203
The sequence shown below is from the reference sequence of NM_004203. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGTTTGAGGACACCCTAGACCCAACCTGAGCCCCAGACTCTGCCTCTGCACTTTTAACCTTTTATCCT
GTGTCTCTCCCGTCGCCCTTGAAAGCTGGGGCCCCTCGGGAACTCCCATGGTCTTCTCTGCCTGGCCGT
GTCTAATAAAAAGTATTTGAACCTTGGGAGCACCCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004203.5
Synonyms MYT1; PPP1R126
Summary This gene encodes a member of the serine/threonine protein kinase family. The encoded protein is a membrane-associated kinase that negatively regulates the G2/M transition of the cell cycle by phosphorylating and inactivating cyclin-dependent kinase 1. The activity of the encoded protein is regulated by polo-like kinase 1. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
Locus ID 9088
MW 6.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...