Pepsin (PGA5) (NM_014224) Human 3' UTR Clone

CAT#: SC201841

3' UTR clone of pepsinogen 5 group I (pepsinogen A) (PGA5) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Pepsin (PGA5) (NM_014224) Human 3' UTR Clone
Vector pMirTarget
Synonyms Pg5
ACCN NM_014224
Insert Size 193 bp
Sequence Data
>SC201841 3’UTR clone of NM_014224
The sequence shown below is from the reference sequence of NM_014224. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AACCAGGTCGGCCTGGCCCCTGTGGCTTAAGCCTAAGTCTCTTCAGCCACCTCCCAGGAAGATCTGGCC
TCCGTCCTATGCCCACTTTAGATGTATCTAATTCTCCTGACTGTTCTTCCCAGGGGAGTGTGAAGGTCT
TGGCCCTGTTCCCTGTCCTACCAATAACGTAGAATAAAAACATAACCCACTGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014224.5
Synonyms Pg5
Summary This gene encodes a protein precursor of the digestive enzyme pepsin, a member of the peptidase A1 family of endopeptidases. The encoded precursor is secreted by gastric chief cells and undergoes autocatalytic cleavage in acidic conditions to form the active enzyme, which functions in the digestion of dietary proteins. This gene is found in a cluster of related genes on chromosome 11, each of which encodes one of multiple pepsinogens. Pepsinogen levels in serum may serve as a biomarker for atrophic gastritis and gastric cancer. [provided by RefSeq, Jul 2015]
Locus ID 5222
MW 7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...