Calpain 9 (CAPN9) (NM_006615) Human 3' UTR Clone

CAT#: SC201836

3' UTR clone of calpain 9 (CAPN9) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Calpain 9 (CAPN9) (NM_006615) Human 3' UTR Clone
Vector pMirTarget
Synonyms GC36; nCL-4
ACCN NM_006615
Insert Size 197 bp
Sequence Data
>SC201836 3' UTR clone of NM_006615
The sequence shown below is from the reference sequence of NM_006615. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCATTTGACAATGAACATCTGAGGCTGCCTTGTAGAGATGCAGCCTGCCCAGCTGAATCTTGGCTTCTGG
ACCTTGACCTTCAGAACTTCTCTTGGTGTGGAACCATTACGCCCAGGGTTCACTCCCCTCTCATCGTCCG
GCCTTCTCCCTTCATCTTGATCTGGGAAGAATGAAATGAACTCAGCTACACTCTCTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006615.2
Synonyms GC36; nCL-4
Summary Calpains are ubiquitous, well-conserved family of calcium-dependent, cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large subunit possesses a cysteine protease domain, and both subunits possess calcium-binding domains. Calpains have been implicated in neurodegenerative processes, as their activation can be triggered by calcium influx and oxidative stress. The protein encoded by this gene is expressed predominantly in stomach and small intestine and may have specialized functions in the digestive tract. This gene is thought to be associated with gastric cancer. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 10753
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...