IFITM3 (NM_021034) Human 3' UTR Clone

CAT#: SC201832

3' UTR clone of interferon induced transmembrane protein 3 (1-8U) (IFITM3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name IFITM3 (NM_021034) Human 3' UTR Clone
Vector pMirTarget
Synonyms 1-8U; DSPA2b; IP15
ACCN NM_021034
Insert Size 192 bp
Sequence Data
>SC201832 3’UTR clone of NM_021034
The sequence shown below is from the reference sequence of NM_021034. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCAGTGCTGATCTTCCAGGCCTATGGATAGATCAGGAGGCATCACTGAGGCCAGGAGCTCTGCCCATGA
CCTGTATCCCACGTACTCCAACTTCCATTCCTCGCCCTGCCCCCGGAGCCGAGTCCTGTATCAGCCCTT
TATCCTCACACGCTTTTCTACAATGGCATTCAATAAAGTGCACGTGTTTCTGGT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_021034.3
Synonyms 1-8U; DSPA2b; IP15
Summary The protein encoded by this gene is an interferon-induced membrane protein that helps confer immunity to influenza A H1N1 virus, West Nile virus, and dengue virus. Two transcript variants, only one of them protein-coding, have been found for this gene. Another variant encoding an N-terminally truncated isoform has been reported, but the full-length nature of this variant has not been determined. [provided by RefSeq, May 2012]
Locus ID 10410
MW 7.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...