GAD67 (GAD1) (NM_013445) Human 3' UTR Clone

CAT#: SC201753

3' UTR clone of glutamate decarboxylase 1 (brain 67kDa) (GAD1) transcript variant GAD25 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name GAD67 (GAD1) (NM_013445) Human 3' UTR Clone
Vector pMirTarget
Synonyms CPSQ1; DEE89; GAD; SCP
ACCN NM_013445
Insert Size 184 bp
Sequence Data
>SC201753 3’UTR clone of NM_013445
The sequence shown below is from the reference sequence of NM_013445. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACATGAGGGAGTGTTGGTTGCTACGGTGATGGGGCTCAGAGCAGAACCAAAGCATGATTGTGACCTCC
AGAGGTGATGGTAACTGCACACATGGTTTCCAAGGGTCTTCCTCCTAAATTTCCAGGGGCCTCCCAAGG
AAAATGGACATATTCTTTTTGGAAATAAAATACTTCTACCAACATA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_013445.4
Synonyms CPSQ1; DEE89; GAD; SCP
Summary This gene encodes one of several forms of glutamic acid decarboxylase, identified as a major autoantigen in insulin-dependent diabetes. The enzyme encoded is responsible for catalyzing the production of gamma-aminobutyric acid from L-glutamic acid. A pathogenic role for this enzyme has been identified in the human pancreas since it has been identified as an autoantigen and an autoreactive T cell target in insulin-dependent diabetes. This gene may also play a role in the stiff man syndrome. Deficiency in this enzyme has been shown to lead to pyridoxine dependency with seizures. Alternative splicing of this gene results in two products, the predominant 67-kD form and a less-frequent 25-kD form. [provided by RefSeq, Jul 2008]
Locus ID 2571
MW 7.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...