UTP14A (NM_006649) Human 3' UTR Clone

CAT#: SC201752

3' UTR clone of UTP14 U3 small nucleolar ribonucleoprotein homolog A (yeast) (UTP14A) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name UTP14A (NM_006649) Human 3' UTR Clone
Vector pMirTarget
Synonyms dJ537K23.3; NYCO16; SDCCAG16; Utp14
ACCN NM_006649
Insert Size 174 bp
Sequence Data
>SC201752 3’UTR clone of NM_006649
The sequence shown below is from the reference sequence of NM_006649. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAACAGCTGAAGAAATGCTCTGTAGATTGAGTTGCTGGAGGAGTGACAGCCAGGAGCCCTGACTTCACT
TCCTTTGGTCCAGTTTTACTCTGATACAGGGTGGATTCCAAAACTGGCTCAGTACATTGCATGTAGTTA
AGCCACATTTTAAAAATAAAGGCATTTTTTAATCTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006649.4
Synonyms dJ537K23.3; NYCO16; SDCCAG16; Utp14
Summary This gene encodes a member of the uridine triphosphate 14 family. As an essential component of a large ribonucleoprotein complex bound to the U3 small nucleolar RNA, the encoded protein is involved in ribosome biogenesis and 18S rRNA synthesis. An autosomal retrotransposed copy of this X-linked gene exists on chromosome 13. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Oct 2009]
Locus ID 10813
MW 6.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...