DCP1B (NM_152640) Human 3' UTR Clone

CAT#: SC201741

3' UTR clone of DCP1 decapping enzyme homolog B (S. cerevisiae) (DCP1B) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name DCP1B (NM_152640) Human 3' UTR Clone
Vector pMirTarget
Synonyms DCP1
ACCN NM_152640
Insert Size 183 bp
Sequence Data
>SC201741 3’UTR clone of NM_152640
The sequence shown below is from the reference sequence of NM_152640. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACTCAAGCAGCCATGAAAAAGACTATGTGACAGCAAGGCCTTTTAAAACTGATTTTCAAGGTCCTTCTA
GAACTCCGGCACAAGGTTCTTTCATGTTGAGTGTTGTTTCCTTCAATGTTTCTGCCTTTTTTAAAAAAA
AAGTATGTGTAATATGAAGTAAAATGTTTCAGACTTTTTTTTATA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_152640.5
Synonyms DCP1
Summary This gene encodes a member of a family of proteins that function in removing the 5' cap from mRNAs, which is a step in regulated mRNA decay. This protein localizes to cytoplasmic foci which are the site of mRNA breakdown and turnover. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Locus ID 196513
MW 7.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...