SEM1 (NM_006304) Human 3' UTR Clone

CAT#: SC201694

3' UTR clone of split hand/foot malformation (ectrodactyly) type 1 (SHFM1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name SEM1 (NM_006304) Human 3' UTR Clone
Vector pMirTarget
Synonyms C7orf76; DSS1; ECD; PSMD15; SHFD1; Shfdg1; SHFM1; SHSF1
ACCN NM_006304
Insert Size 192 bp
Sequence Data
>SC201694 3’UTR clone of NM_006304
The sequence shown below is from the reference sequence of NM_006304. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAACATGGTTATAAGATGGAGACTTCATAGCATCCAGAAGAAGTGTTGAAGTAACCTAAACTTGACCTG
CTTAATACATTCTAGGGCAGAGAACCCAGGATGGGACACTAAAAAAATGTGTTTATTTCATTATCTGCT
TGGATTTATTTGTGTTTTTGTAACACAAAAAATAAATGTTTTGATATAATCTTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006304.2
Synonyms C7orf76; DSS1; ECD; PSMD15; SHFD1; Shfdg1; SHFM1; SHSF1
Summary The product of this gene has been localized within the split hand/split foot malformation locus SHFM1 at chromosome 7. It has been proposed to be a candidate gene for the autosomal dominant form of the heterogeneous limb developmental disorder split hand/split foot malformation type 1. In addition, it has been shown to directly interact with BRCA2. It also may play a role in the completion of the cell cycle. [provided by RefSeq, Jul 2008]
Locus ID 7979
MW 7.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...