CHD2 (NM_001042572) Human 3' UTR Clone

CAT#: SC201681

3' UTR clone of chromodomain helicase DNA binding protein 2 (CHD2) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CN¥ 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CN¥ 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00

Specifications

Product Data
Product Name CHD2 (NM_001042572) Human 3' UTR Clone
Vector pMirTarget
Synonyms DEE94; EEOC
ACCN NM_001042572
Insert Size 184 bp
Sequence Data
>SC201681 3’UTR clone of NM_001042572
The sequence shown below is from the reference sequence of NM_001042572. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AACTGGCTAGCTCATTCCTGGTGCAAGTAGGTAGAAAAATATGAGTGCAATTTTCCTTACTGTTTCTGG
CTTCTTTATTGTTAGATGTCAAGAATTTTTTTTTTCTTTTTTCACACCCTTATTGTATCTCAACCAAGA
AATCTTTATGCTGCATATTACAGAAATAAAAGATGATTGAGAGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001042572.3
Synonyms DEE94; EEOC
Summary The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 1106
MW 7.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...