TAF6 (NM_139122) Human 3' UTR Clone

CAT#: SC201677

3' UTR clone of TAF6 RNA polymerase II TATA box binding protein (TBP)-associated factor 80kDa (TAF6) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name TAF6 (NM_139122) Human 3' UTR Clone
Vector pMirTarget
Synonyms DKFZp781E21155; MGC:8964; TAF(II)80; TAF2E; TAFII70; TAFII80; TAFII85
ACCN NM_139122
Insert Size 197 bp
Sequence Data
>SC201677 3’UTR clone of NM_139122
The sequence shown below is from the reference sequence of NM_139122. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AACTCCGGCTCCCCTCAGCCTGCTCCGTGATGCTCCACCTGCCAGCCCCCGGATTCCCACACATGCAGA
CATGTACACACGTGCACGTACACACATGCATGCTCGCTAAGCGGAAGGAAGTTGTAGATTGCTTCCTTC
ATGTCACTTTCTTTTTAGATATTGTACAGCCAGTTTCTCAGAATAAAAGTTTGGTTTGT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_139122.1
Synonyms DKFZp781E21155; MGC:8964; TAF(II)80; TAF2E; TAFII70; TAFII80; TAFII85
Summary Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the smaller subunits of TFIID that binds weakly to TBP but strongly to TAF1, the largest subunit of TFIID. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]
Locus ID 6878
MW 7.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...