GSTA3 (NM_000847) Human 3' UTR Clone

CAT#: SC201667

3' UTR clone of glutathione S-transferase alpha 3 (GSTA3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CN¥ 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CN¥ 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00

Specifications

Product Data
Product Name GSTA3 (NM_000847) Human 3' UTR Clone
Vector pMirTarget
Synonyms GSTA3-3; GTA3
ACCN NM_000847
Insert Size 190 bp
Sequence Data
>SC201667 3’UTR clone of NM_000847
The sequence shown below is from the reference sequence of NM_000847. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAAGAAGCCAGAAAGATTTTCAGGTTTTAATAAAGCAGCCATGGAGGCTAAGAACATGCAAGACCAATA
TTCTAAAGTTTTGCAACAATGAAGTGCTTTACTTAAGTGTTGATTGTGCCTGTTGTAAAGCTAATGAAC
CCTTTCCAATTATATGCTAATTAAATAATAAAAACTCCTATTTGCTAACTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000847.5
Synonyms GSTA3-3; GTA3
Summary Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. These enzymes are involved in cellular defense against toxic, carcinogenic, and pharmacologically active electrophilic compounds. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-tranferase belonging to the alpha class genes that are located in a cluster mapped to chromosome 6. Genes of the alpha class are highly related and encode enzymes with glutathione peroxidase activity. However, during evolution, this alpha class gene diverged accumulating mutations in the active site that resulted in differences in substrate specificity and catalytic activity. The enzyme encoded by this gene catalyzes the double bond isomerization of precursors for progesterone and testosterone during the biosynthesis of steroid hormones. An additional transcript variant has been identified, but its full length sequence has not been determined. [provided by RefSeq, Jul 2008]
Locus ID 2940
MW 7.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...