HE4 (WFDC2) (NM_006103) Human 3' UTR Clone

CAT#: SC201666

3' UTR clone of WAP four-disulfide core domain 2 (WFDC2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name HE4 (WFDC2) (NM_006103) Human 3' UTR Clone
Vector pMirTarget
Synonyms dJ461P17.6; EDDM4; HE4; WAP5
ACCN NM_006103
Insert Size 193 bp
Sequence Data
>SC201666 3’UTR clone of NM_006103
The sequence shown below is from the reference sequence of NM_006103. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGGTGTCCTGTGTCACTCCCAATTTCTGAGCTCCAGCCACCACCAGGCTGAGCAGTGAGGAGAGAAAG
TTTCTGCCTGGCCCTGCATCTGGTTCCAGCCCACCTGCCCTCCCCTTTTTCGGGACTCTGTATTCCCTC
TTGGGCTGACCACAGCTTCTCCCTTTCCCAACCAATAAAGTAACCACTTTCAGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006103.4
Synonyms dJ461P17.6; EDDM4; HE4; WAP5
Summary This gene encodes a protein that is a member of the WFDC domain family. The WFDC domain, or WAP Signature motif, contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor in many family members. This gene is expressed in pulmonary epithelial cells, and was also found to be expressed in some ovarian cancers. The encoded protein is a small secretory protein, which may be involved in sperm maturation. [provided by RefSeq, Jul 2008]
Locus ID 10406
MW 6.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...