NCF1 (NM_000265) Human 3' UTR Clone

CAT#: SC201664

3' UTR clone of neutrophil cytosolic factor 1 (NCF1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name NCF1 (NM_000265) Human 3' UTR Clone
Vector pMirTarget
Synonyms CGD1; NCF1A; NOXO2; p47phox; SH3PXD1A
ACCN NM_000265
Insert Size 185 bp
Sequence Data
>SC201664 3’UTR clone of NM_000265
The sequence shown below is from the reference sequence of NM_000265. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACCAAGCGGAAGCTGGCGTCTGCCGTCTGAGGCTGGAGCGCAGTCCCCAGCTAGCGTCTCGGCCCTTGC
CGCCCCGTGCCTGTATATACGTGTTCTATAGAGCCTGGCGTCTGGACGCCGAGGGCAGCCCCGACCCCT
GTCCAGCGCGGCTCCCGCCACCCTCAATAAATGTTGCTTGGAGTGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000265.7
Synonyms CGD1; NCF1A; NOXO2; p47phox; SH3PXD1A
Summary The protein encoded by this gene is a 47 kDa cytosolic subunit of neutrophil NADPH oxidase. This oxidase is a multicomponent enzyme that is activated to produce superoxide anion. Mutations in this gene have been associated with chronic granulomatous disease. [provided by RefSeq, Jul 2008]
Locus ID 653361
MW 6.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...