OVGP1 (NM_002557) Human 3' UTR Clone

CAT#: SC201646

3' UTR clone of oviductal glycoprotein 1 120kDa (OVGP1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name OVGP1 (NM_002557) Human 3' UTR Clone
Vector pMirTarget
Synonyms CHIT5; EGP; MUC9; OGP
ACCN NM_002557
Insert Size 175 bp
Sequence Data
>SC201646 3’UTR clone of NM_002557
The sequence shown below is from the reference sequence of NM_002557. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAAAACTCTGCTGTGGATGAAGAAGCCTAAGCCCCTCTGGTGTCAGAAACCAGGGAAAACCCTTGTCTT
TTCTTCTAAGTGACATGTTGGAAGCCTTCTCATCCCGGGGCAAAGCAGGCATCAAAACCAGAATAGGCC
AATCTCTTTTCCATTAAATAAACTGTAAACACAAGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002557.4
Synonyms CHIT5; EGP; MUC9; OGP
Summary This gene encodes a large, carbohydrate-rich, epithelial glycoprotein with numerous O-glycosylation sites located within threonine, serine, and proline-rich tandem repeats. The gene is similar to members of the mucin and the glycosyl hydrolase 18 gene families. Regulation of expression may be estrogen-dependent. Gene expression and protein secretion occur during late follicular development through early cleavage-stage embryonic development. The protein is secreted from non-ciliated oviductal epithelial cells and associates with ovulated oocytes, blastomeres, and spermatozoan acrosomal regions. [provided by RefSeq, Jul 2008]
Locus ID 5016
MW 6.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...