NFkB p100 / p52 (NFKB2) (NM_001077494) Human 3' UTR Clone

CAT#: SC201570

3' UTR clone of nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100) (NFKB2) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name NFkB p100 / p52 (NFKB2) (NM_001077494) Human 3' UTR Clone
Vector pMirTarget
Synonyms CVID10; H2TF1; LYT-10; LYT10; NF-kB2; p49/p100; p52; p100
ACCN NM_001077494
Insert Size 183 bp
Sequence Data
>SC201570 3’UTR clone of NM_001077494
The sequence shown below is from the reference sequence of NM_001077494. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CACGGGCACCCCCAGCCTCAGGTGCACTGACCTGCTGCCTGCCCCCAGCCCCCTTCCCGGACCCCCTGT
ACAGCGTCCCCACCTATTTCAAATCTTATTTAACACCCCACACCCACCCCTCAGTTGGGACAAATAAAG
GATTCTCATGGGAAGGGGAGGACCCCTCCTTCCCAACTTATGGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001077494.3
Synonyms CVID10; H2TF1; LYT-10; LYT10; NF-kB2; p49/p100; p52; p100
Summary This gene encodes a subunit of the transcription factor complex nuclear factor-kappa-B (NFkB). The NFkB complex is expressed in numerous cell types and functions as a central activator of genes involved in inflammation and immune function. The protein encoded by this gene can function as both a transcriptional activator or repressor depending on its dimerization partner. The p100 full-length protein is co-translationally processed into a p52 active form. Chromosomal rearrangements and translocations of this locus have been observed in B cell lymphomas, some of which may result in the formation of fusion proteins. There is a pseudogene for this gene on chromosome 18. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Locus ID 4791
MW 6.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...