AIMP2 (NM_006303) Human 3' UTR Clone

CAT#: SC201563

3' UTR clone of aminoacyl tRNA synthetase complex-interacting multifunctional protein 2 (AIMP2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name AIMP2 (NM_006303) Human 3' UTR Clone
Vector pMirTarget
Synonyms HLD17; JTV-1; JTV1; P38
ACCN NM_006303
Insert Size 173 bp
Sequence Data
>SC201563 3’UTR clone of NM_006303
The sequence shown below is from the reference sequence of NM_006303. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTTAACACGGCCCTCAAGCTCCTTAAGTGAATTGCCGTAACTGATTTTAAAGGGTTTAGATTTTAAGAA
TGGTGCTCTTTCATGCCTATTATCAGTAAGGGGACTTGTATTAGAGTCAGAGTCTTTTTATTTAGGCCA
GTTGTCAAGTGTCAATAAAAGCATCATGTAATTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006303.4
Synonyms HLD17; JTV-1; JTV1; P38
Summary The protein encoded by this gene is part of the aminoacyl-tRNA synthetase complex, which contains nine different aminoacyl-tRNA synthetases and three non-enzymatic factors. The encoded protein is one of the non-enzymatic factors and is required for assembly and stability of the complex. [provided by RefSeq, May 2016]
Locus ID 7965
MW 6.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...