Pepsinogen II (PGC) (NM_002630) Human 3' UTR Clone

CAT#: SC201532

3' UTR clone of progastricsin (pepsinogen C) (PGC) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Pepsinogen II (PGC) (NM_002630) Human 3' UTR Clone
Vector pMirTarget
Synonyms PEPC; PGII
ACCN NM_002630
Insert Size 171 bp
Sequence Data
>SC201532 3’UTR clone of NM_002630
The sequence shown below is from the reference sequence of NM_002630. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AACAGAGTAGGCTTTGCCACTGCCGCCTAGACTTGCTGCCTCGACACGTGGGCTCCCCTCTTCCTCTTG
ACCCTGCACCCTCCTAGGGCATTGTATCTGTCTTTCCACTCTGGATTCAGCCTTCTTTTTCTGGACTCT
GGACTTTCTCTAATAATAAATAGTTCTTCTTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002630.4
Synonyms PEPC; PGII
Summary This gene encodes an aspartic proteinase that belongs to the peptidase family A1. The encoded protein is a digestive enzyme that is produced in the stomach and constitutes a major component of the gastric mucosa. This protein is also secreted into the serum. This protein is synthesized as an inactive zymogen that includes a highly basic prosegment. This enzyme is converted into its active mature form at low pH by sequential cleavage of the prosegment that is carried out by the enzyme itself. Polymorphisms in this gene are associated with susceptibility to gastric cancers. Serum levels of this enzyme are used as a biomarker for certain gastric diseases including Helicobacter pylori related gastritis. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 1. [provided by RefSeq, Oct 2009]
Locus ID 5225
MW 6.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...